aav2 vector backbone Search Results


99
New England Biolabs dpni
Dpni, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/dpni/product/New England Biolabs
Average 99 stars, based on 1 article reviews
dpni - by Bioz Stars, 2026-06
99/100 stars
  Buy from Supplier

96
Addgene inc aav2 vector backbone
Aav2 Vector Backbone, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/aav2 vector backbone/product/Addgene inc
Average 96 stars, based on 1 article reviews
aav2 vector backbone - by Bioz Stars, 2026-06
96/100 stars
  Buy from Supplier

93
Addgene inc aav5 esrrg
a Of the 56 genes that are reduced with synucleinopathy and expressed in dopaminergic neurons , 29 genes are also direct targets of <t>ESRRG</t> . sm-FISH in human ( b ) or mouse ( c ) SNc for both Esrrg (green ) and Th (red) transcripts demonstrate expression of Esrrg in DAergic neurons. sm-FISH for Esrrg transcript was quantified in Th -positive neurons from the dorsal tier to the medial tier of the SNc in mice ( n = 5 mice/group repeated measures one-way ANOVA with Tukey’s post hoc analysis * p < 0.05, ** p < 0.01). d sm-FISH for Esrrg (green) , Th (red), and Aldh1a1 (white) shows Esrrg is more highly expressed in the Aldh1a + population compared to the Aldh1a1− population ( n = 3 mice/group; two-tailed unpaired t -test *** p < 0.001). Numbers on bars are total cell counts from each group of an experiment. Scale bars correspond to 50 µm ( b , c ) and 10 µm ( b , c ). Error bars represent ±SEM.
Aav5 Esrrg, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/aav5 esrrg/product/Addgene inc
Average 93 stars, based on 1 article reviews
aav5 esrrg - by Bioz Stars, 2026-06
93/100 stars
  Buy from Supplier

90
Avigen Inc aav2 vector plasmid pa2hsn5′
Shuttle vector rescue of targeted loci. ( A ) Maps of AAV targeting vector <t>AAV2-HSN5′</t> containing a neo gene truncated at bp 629 and an MLV vector LHSN37Δ4O provirus containing a 4-bp deletion in neo at bp 37. The locations of the AAV inverted terminal repeats (ITRs), simian virus 40 (SV40) and Tn5 promoters, transcriptional start sites (arrows), hph and neo genes, p15A replication origin, and retrovirus long terminal repeats (LTR) are shown. The fragment used to probe Southern blots is indicated. The strategy used for recovering targeted loci is shown below. ( B ) Southern blot of genomic DNA from HT-1080-derived clonal cell lines containing a single copy of the LHSN37Δ4O provirus, digested with EcoRI and probed for hph sequences. The positions of size standards are shown on the left. ( C ) Southern blot of genomic DNA from HT-1080-derived clonal cell lines containing two copies of the LHSN37Δ4O provirus, with clone 17 as a single-copy control, digested and probed as in (B).
Aav2 Vector Plasmid Pa2hsn5′, supplied by Avigen Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/aav2 vector plasmid pa2hsn5′/product/Avigen Inc
Average 90 stars, based on 1 article reviews
aav2 vector plasmid pa2hsn5′ - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

93
Addgene inc aav2.7m8 capsid plasmids
Shuttle vector rescue of targeted loci. ( A ) Maps of AAV targeting vector <t>AAV2-HSN5′</t> containing a neo gene truncated at bp 629 and an MLV vector LHSN37Δ4O provirus containing a 4-bp deletion in neo at bp 37. The locations of the AAV inverted terminal repeats (ITRs), simian virus 40 (SV40) and Tn5 promoters, transcriptional start sites (arrows), hph and neo genes, p15A replication origin, and retrovirus long terminal repeats (LTR) are shown. The fragment used to probe Southern blots is indicated. The strategy used for recovering targeted loci is shown below. ( B ) Southern blot of genomic DNA from HT-1080-derived clonal cell lines containing a single copy of the LHSN37Δ4O provirus, digested with EcoRI and probed for hph sequences. The positions of size standards are shown on the left. ( C ) Southern blot of genomic DNA from HT-1080-derived clonal cell lines containing two copies of the LHSN37Δ4O provirus, with clone 17 as a single-copy control, digested and probed as in (B).
Aav2.7m8 Capsid Plasmids, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/aav2.7m8 capsid plasmids/product/Addgene inc
Average 93 stars, based on 1 article reviews
aav2.7m8 capsid plasmids - by Bioz Stars, 2026-06
93/100 stars
  Buy from Supplier

96
Addgene inc aav2 9 hsyn hchr2 h134r eyfp
Shuttle vector rescue of targeted loci. ( A ) Maps of AAV targeting vector <t>AAV2-HSN5′</t> containing a neo gene truncated at bp 629 and an MLV vector LHSN37Δ4O provirus containing a 4-bp deletion in neo at bp 37. The locations of the AAV inverted terminal repeats (ITRs), simian virus 40 (SV40) and Tn5 promoters, transcriptional start sites (arrows), hph and neo genes, p15A replication origin, and retrovirus long terminal repeats (LTR) are shown. The fragment used to probe Southern blots is indicated. The strategy used for recovering targeted loci is shown below. ( B ) Southern blot of genomic DNA from HT-1080-derived clonal cell lines containing a single copy of the LHSN37Δ4O provirus, digested with EcoRI and probed for hph sequences. The positions of size standards are shown on the left. ( C ) Southern blot of genomic DNA from HT-1080-derived clonal cell lines containing two copies of the LHSN37Δ4O provirus, with clone 17 as a single-copy control, digested and probed as in (B).
Aav2 9 Hsyn Hchr2 H134r Eyfp, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/aav2 9 hsyn hchr2 h134r eyfp/product/Addgene inc
Average 96 stars, based on 1 article reviews
aav2 9 hsyn hchr2 h134r eyfp - by Bioz Stars, 2026-06
96/100 stars
  Buy from Supplier

90
SignaGen tpp1-expression construct derived human tpp1 cdna
Shuttle vector rescue of targeted loci. ( A ) Maps of AAV targeting vector <t>AAV2-HSN5′</t> containing a neo gene truncated at bp 629 and an MLV vector LHSN37Δ4O provirus containing a 4-bp deletion in neo at bp 37. The locations of the AAV inverted terminal repeats (ITRs), simian virus 40 (SV40) and Tn5 promoters, transcriptional start sites (arrows), hph and neo genes, p15A replication origin, and retrovirus long terminal repeats (LTR) are shown. The fragment used to probe Southern blots is indicated. The strategy used for recovering targeted loci is shown below. ( B ) Southern blot of genomic DNA from HT-1080-derived clonal cell lines containing a single copy of the LHSN37Δ4O provirus, digested with EcoRI and probed for hph sequences. The positions of size standards are shown on the left. ( C ) Southern blot of genomic DNA from HT-1080-derived clonal cell lines containing two copies of the LHSN37Δ4O provirus, with clone 17 as a single-copy control, digested and probed as in (B).
Tpp1 Expression Construct Derived Human Tpp1 Cdna, supplied by SignaGen, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/tpp1-expression construct derived human tpp1 cdna/product/SignaGen
Average 90 stars, based on 1 article reviews
tpp1-expression construct derived human tpp1 cdna - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

93
Addgene inc aav itr u6 sgrna backbone hsyn cre 2a egfp kash wpre shortpa itr plasmid
Shuttle vector rescue of targeted loci. ( A ) Maps of AAV targeting vector <t>AAV2-HSN5′</t> containing a neo gene truncated at bp 629 and an MLV vector LHSN37Δ4O provirus containing a 4-bp deletion in neo at bp 37. The locations of the AAV inverted terminal repeats (ITRs), simian virus 40 (SV40) and Tn5 promoters, transcriptional start sites (arrows), hph and neo genes, p15A replication origin, and retrovirus long terminal repeats (LTR) are shown. The fragment used to probe Southern blots is indicated. The strategy used for recovering targeted loci is shown below. ( B ) Southern blot of genomic DNA from HT-1080-derived clonal cell lines containing a single copy of the LHSN37Δ4O provirus, digested with EcoRI and probed for hph sequences. The positions of size standards are shown on the left. ( C ) Southern blot of genomic DNA from HT-1080-derived clonal cell lines containing two copies of the LHSN37Δ4O provirus, with clone 17 as a single-copy control, digested and probed as in (B).
Aav Itr U6 Sgrna Backbone Hsyn Cre 2a Egfp Kash Wpre Shortpa Itr Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/aav itr u6 sgrna backbone hsyn cre 2a egfp kash wpre shortpa itr plasmid/product/Addgene inc
Average 93 stars, based on 1 article reviews
aav itr u6 sgrna backbone hsyn cre 2a egfp kash wpre shortpa itr plasmid - by Bioz Stars, 2026-06
93/100 stars
  Buy from Supplier

90
GenScript corporation cdna with a c-terminal 3xha tag (1xha: tatccctatgacgtgcctgattacgcc) and arms of homology (250 each)
Shuttle vector rescue of targeted loci. ( A ) Maps of AAV targeting vector <t>AAV2-HSN5′</t> containing a neo gene truncated at bp 629 and an MLV vector LHSN37Δ4O provirus containing a 4-bp deletion in neo at bp 37. The locations of the AAV inverted terminal repeats (ITRs), simian virus 40 (SV40) and Tn5 promoters, transcriptional start sites (arrows), hph and neo genes, p15A replication origin, and retrovirus long terminal repeats (LTR) are shown. The fragment used to probe Southern blots is indicated. The strategy used for recovering targeted loci is shown below. ( B ) Southern blot of genomic DNA from HT-1080-derived clonal cell lines containing a single copy of the LHSN37Δ4O provirus, digested with EcoRI and probed for hph sequences. The positions of size standards are shown on the left. ( C ) Southern blot of genomic DNA from HT-1080-derived clonal cell lines containing two copies of the LHSN37Δ4O provirus, with clone 17 as a single-copy control, digested and probed as in (B).
Cdna With A C Terminal 3xha Tag (1xha: Tatccctatgacgtgcctgattacgcc) And Arms Of Homology (250 Each), supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/cdna with a c-terminal 3xha tag (1xha: tatccctatgacgtgcctgattacgcc) and arms of homology (250 each)/product/GenScript corporation
Average 90 stars, based on 1 article reviews
cdna with a c-terminal 3xha tag (1xha: tatccctatgacgtgcctgattacgcc) and arms of homology (250 each) - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

99
New England Biolabs xhoi
Shuttle vector rescue of targeted loci. ( A ) Maps of AAV targeting vector <t>AAV2-HSN5′</t> containing a neo gene truncated at bp 629 and an MLV vector LHSN37Δ4O provirus containing a 4-bp deletion in neo at bp 37. The locations of the AAV inverted terminal repeats (ITRs), simian virus 40 (SV40) and Tn5 promoters, transcriptional start sites (arrows), hph and neo genes, p15A replication origin, and retrovirus long terminal repeats (LTR) are shown. The fragment used to probe Southern blots is indicated. The strategy used for recovering targeted loci is shown below. ( B ) Southern blot of genomic DNA from HT-1080-derived clonal cell lines containing a single copy of the LHSN37Δ4O provirus, digested with EcoRI and probed for hph sequences. The positions of size standards are shown on the left. ( C ) Southern blot of genomic DNA from HT-1080-derived clonal cell lines containing two copies of the LHSN37Δ4O provirus, with clone 17 as a single-copy control, digested and probed as in (B).
Xhoi, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/xhoi/product/New England Biolabs
Average 99 stars, based on 1 article reviews
xhoi - by Bioz Stars, 2026-06
99/100 stars
  Buy from Supplier

93
Addgene inc viruses paav 2 multiple cloning site mcs backbone
Shuttle vector rescue of targeted loci. ( A ) Maps of AAV targeting vector <t>AAV2-HSN5′</t> containing a neo gene truncated at bp 629 and an MLV vector LHSN37Δ4O provirus containing a 4-bp deletion in neo at bp 37. The locations of the AAV inverted terminal repeats (ITRs), simian virus 40 (SV40) and Tn5 promoters, transcriptional start sites (arrows), hph and neo genes, p15A replication origin, and retrovirus long terminal repeats (LTR) are shown. The fragment used to probe Southern blots is indicated. The strategy used for recovering targeted loci is shown below. ( B ) Southern blot of genomic DNA from HT-1080-derived clonal cell lines containing a single copy of the LHSN37Δ4O provirus, digested with EcoRI and probed for hph sequences. The positions of size standards are shown on the left. ( C ) Southern blot of genomic DNA from HT-1080-derived clonal cell lines containing two copies of the LHSN37Δ4O provirus, with clone 17 as a single-copy control, digested and probed as in (B).
Viruses Paav 2 Multiple Cloning Site Mcs Backbone, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/viruses paav 2 multiple cloning site mcs backbone/product/Addgene inc
Average 93 stars, based on 1 article reviews
viruses paav 2 multiple cloning site mcs backbone - by Bioz Stars, 2026-06
93/100 stars
  Buy from Supplier

93
Addgene inc aav backbone
Shuttle vector rescue of targeted loci. ( A ) Maps of AAV targeting vector <t>AAV2-HSN5′</t> containing a neo gene truncated at bp 629 and an MLV vector LHSN37Δ4O provirus containing a 4-bp deletion in neo at bp 37. The locations of the AAV inverted terminal repeats (ITRs), simian virus 40 (SV40) and Tn5 promoters, transcriptional start sites (arrows), hph and neo genes, p15A replication origin, and retrovirus long terminal repeats (LTR) are shown. The fragment used to probe Southern blots is indicated. The strategy used for recovering targeted loci is shown below. ( B ) Southern blot of genomic DNA from HT-1080-derived clonal cell lines containing a single copy of the LHSN37Δ4O provirus, digested with EcoRI and probed for hph sequences. The positions of size standards are shown on the left. ( C ) Southern blot of genomic DNA from HT-1080-derived clonal cell lines containing two copies of the LHSN37Δ4O provirus, with clone 17 as a single-copy control, digested and probed as in (B).
Aav Backbone, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/aav backbone/product/Addgene inc
Average 93 stars, based on 1 article reviews
aav backbone - by Bioz Stars, 2026-06
93/100 stars
  Buy from Supplier

Image Search Results


a Of the 56 genes that are reduced with synucleinopathy and expressed in dopaminergic neurons , 29 genes are also direct targets of ESRRG . sm-FISH in human ( b ) or mouse ( c ) SNc for both Esrrg (green ) and Th (red) transcripts demonstrate expression of Esrrg in DAergic neurons. sm-FISH for Esrrg transcript was quantified in Th -positive neurons from the dorsal tier to the medial tier of the SNc in mice ( n = 5 mice/group repeated measures one-way ANOVA with Tukey’s post hoc analysis * p < 0.05, ** p < 0.01). d sm-FISH for Esrrg (green) , Th (red), and Aldh1a1 (white) shows Esrrg is more highly expressed in the Aldh1a + population compared to the Aldh1a1− population ( n = 3 mice/group; two-tailed unpaired t -test *** p < 0.001). Numbers on bars are total cell counts from each group of an experiment. Scale bars correspond to 50 µm ( b , c ) and 10 µm ( b , c ). Error bars represent ±SEM.

Journal: NPJ Parkinson's Disease

Article Title: Estrogen-related receptor gamma regulates mitochondrial and synaptic genes and modulates vulnerability to synucleinopathy

doi: 10.1038/s41531-022-00369-w

Figure Lengend Snippet: a Of the 56 genes that are reduced with synucleinopathy and expressed in dopaminergic neurons , 29 genes are also direct targets of ESRRG . sm-FISH in human ( b ) or mouse ( c ) SNc for both Esrrg (green ) and Th (red) transcripts demonstrate expression of Esrrg in DAergic neurons. sm-FISH for Esrrg transcript was quantified in Th -positive neurons from the dorsal tier to the medial tier of the SNc in mice ( n = 5 mice/group repeated measures one-way ANOVA with Tukey’s post hoc analysis * p < 0.05, ** p < 0.01). d sm-FISH for Esrrg (green) , Th (red), and Aldh1a1 (white) shows Esrrg is more highly expressed in the Aldh1a + population compared to the Aldh1a1− population ( n = 3 mice/group; two-tailed unpaired t -test *** p < 0.001). Numbers on bars are total cell counts from each group of an experiment. Scale bars correspond to 50 µm ( b , c ) and 10 µm ( b , c ). Error bars represent ±SEM.

Article Snippet: Viruses included AAV9.rTH.PI.Cre.SV40 (AAV9: ThCre ; AddGene# 107788), AAV5-h Syn -GFP-Cre (University of North Carolina Vector Core), AAV5: Gfp , or AAV5: Esrrg (Plasmids generated and cloned into AAV2 backbone with CAG promoter Addgene# 28014 by Genscript; packaged into an AAV5 by Vectorbiolabs; AAV5:CAG- Esrrg- NM_011935.3-IRES-EGFP-WPRE; virus titer 2.0 × 10 12 GC/ml).

Techniques: Expressing, Two Tailed Test

a sm-FISH for Esrrg (green) and Th (red) transcript in Esrrg +/+ and Esrrg fl/fl mice injected with AAV: ThCre into the midbrain, quantified in b ( n = 4 mice/genotype; two-tailed unpaired t -test * p < 0.05 or unpaired nonparametric Kolmogorov–Smirnov test **** p < 0.0001). c – e Ambulatory behavior in Esrrg +/+ and Esrrg fl/fl mice injected with AAV : ThCre (1 month n = 21 mice/genotype; 3 months n = 18–17 mice/genotype; 6 months n = 7 mice/genotype; mixed-effects analysis with Sidak’s post hoc analysis * p < 0.05, ** p < 0.01, **** p < 0.0001). f , g TH and DAT immunoreactivity in the striatum of mice 6 months post-injection (P.I.) ( n = 3/genotype 1-month P.I.; n = 6/genotype 6 months P.I., mixed-effects analysis with Sidak’s post hoc analysis **** p < 0.0001). h TH immunoreactivity in the SNc 6 months P.I. ( n = 6 mice/group; two-tailed unpaired t -test *** p < 0.001). i sm-FISH for Aldh1a1 + populations at 6 months P.I. ( n = 4 mice/group; two-tailed unpaired t -test * p < 0.05). j sm-FISH for mitochondrially encoded gene cytb in mice 1 month P.I. ( n = 4 per group; two-tailed unpaired t -test or unpaired nonparametric Kolmogorov–Smirnov test **** p < 0.0001). k Electron microscopy in neurons stained with TH and deficient in Esrrg at 6 months P.I. ( n = 6 mice/group; two-tailed unpaired t -test * p < 0.05 or unpaired nonparametric Kolmogorov–Smirnov test * p < 0.05, ** p < 0.01). l – n Ambulatory distance, vertical counts, and pole-assay in Esrrg +/+ and Esrrg fl/fl mice 14 months P.I. AAV: ThCre into the midbrain at baseline and after acute injection of L-DOPA ( n = 7 mice/group; two-way ANOVA with Tukey’s post hoc analysis * p < 0.05, ** p < 0.01, *** p < 0.001). Numbers on bars are cell counts from each experiment. Scale bars correspond to 50 µm ( b ),100 µm ( h ), and 200 µm ( f , g ). Error bars represent ±SEM.

Journal: NPJ Parkinson's Disease

Article Title: Estrogen-related receptor gamma regulates mitochondrial and synaptic genes and modulates vulnerability to synucleinopathy

doi: 10.1038/s41531-022-00369-w

Figure Lengend Snippet: a sm-FISH for Esrrg (green) and Th (red) transcript in Esrrg +/+ and Esrrg fl/fl mice injected with AAV: ThCre into the midbrain, quantified in b ( n = 4 mice/genotype; two-tailed unpaired t -test * p < 0.05 or unpaired nonparametric Kolmogorov–Smirnov test **** p < 0.0001). c – e Ambulatory behavior in Esrrg +/+ and Esrrg fl/fl mice injected with AAV : ThCre (1 month n = 21 mice/genotype; 3 months n = 18–17 mice/genotype; 6 months n = 7 mice/genotype; mixed-effects analysis with Sidak’s post hoc analysis * p < 0.05, ** p < 0.01, **** p < 0.0001). f , g TH and DAT immunoreactivity in the striatum of mice 6 months post-injection (P.I.) ( n = 3/genotype 1-month P.I.; n = 6/genotype 6 months P.I., mixed-effects analysis with Sidak’s post hoc analysis **** p < 0.0001). h TH immunoreactivity in the SNc 6 months P.I. ( n = 6 mice/group; two-tailed unpaired t -test *** p < 0.001). i sm-FISH for Aldh1a1 + populations at 6 months P.I. ( n = 4 mice/group; two-tailed unpaired t -test * p < 0.05). j sm-FISH for mitochondrially encoded gene cytb in mice 1 month P.I. ( n = 4 per group; two-tailed unpaired t -test or unpaired nonparametric Kolmogorov–Smirnov test **** p < 0.0001). k Electron microscopy in neurons stained with TH and deficient in Esrrg at 6 months P.I. ( n = 6 mice/group; two-tailed unpaired t -test * p < 0.05 or unpaired nonparametric Kolmogorov–Smirnov test * p < 0.05, ** p < 0.01). l – n Ambulatory distance, vertical counts, and pole-assay in Esrrg +/+ and Esrrg fl/fl mice 14 months P.I. AAV: ThCre into the midbrain at baseline and after acute injection of L-DOPA ( n = 7 mice/group; two-way ANOVA with Tukey’s post hoc analysis * p < 0.05, ** p < 0.01, *** p < 0.001). Numbers on bars are cell counts from each experiment. Scale bars correspond to 50 µm ( b ),100 µm ( h ), and 200 µm ( f , g ). Error bars represent ±SEM.

Article Snippet: Viruses included AAV9.rTH.PI.Cre.SV40 (AAV9: ThCre ; AddGene# 107788), AAV5-h Syn -GFP-Cre (University of North Carolina Vector Core), AAV5: Gfp , or AAV5: Esrrg (Plasmids generated and cloned into AAV2 backbone with CAG promoter Addgene# 28014 by Genscript; packaged into an AAV5 by Vectorbiolabs; AAV5:CAG- Esrrg- NM_011935.3-IRES-EGFP-WPRE; virus titer 2.0 × 10 12 GC/ml).

Techniques: Injection, Two Tailed Test, Electron Microscopy, Staining

a , b sm-FISH for Esrrg (green) and Th (red) transcript in i Slc6a3Cre ; Esrrg +/+ and i Slc6a3Cre ; Esrrg fl/fl mice ( n = 4 mice/genotype; two-tailed unpaired t -test * p < 0.05, or unpaired nonparametric Kolmogorov–Smirnov test **** p < 0.0001). c Quantification of Esrrg by sm-FISH in substantia nigra pars reticulata (SNr). d – f Ambulatory and pole assay behavior up to 9 months post-tamoxifen injection (12 months of age) ( n = 5–13 mice/group; mixed-effects analysis with Sidak’s post hoc analysis * p < 0.05, ** p < 0.01). g sm-FISH for the mitochondrially encoded gene Cytb ( n = 4/group; two-tailed unpaired t -test or unpaired nonparametric Kolmogorov–Smirnov test * p < 0.05, **** p < 0.0001). h sm-FISH for the nuclear-encoded mitochondrial gene Atp5a1 ( n = 4/group; two-tailed unpaired t -test or unpaired nonparametric Kolmogorov–Smirnov test *** p < 0.001). Numbers on bars are cell counts from each experiment. Scale bars correspond to 50 µm a . Error bars represent ±SEM.

Journal: NPJ Parkinson's Disease

Article Title: Estrogen-related receptor gamma regulates mitochondrial and synaptic genes and modulates vulnerability to synucleinopathy

doi: 10.1038/s41531-022-00369-w

Figure Lengend Snippet: a , b sm-FISH for Esrrg (green) and Th (red) transcript in i Slc6a3Cre ; Esrrg +/+ and i Slc6a3Cre ; Esrrg fl/fl mice ( n = 4 mice/genotype; two-tailed unpaired t -test * p < 0.05, or unpaired nonparametric Kolmogorov–Smirnov test **** p < 0.0001). c Quantification of Esrrg by sm-FISH in substantia nigra pars reticulata (SNr). d – f Ambulatory and pole assay behavior up to 9 months post-tamoxifen injection (12 months of age) ( n = 5–13 mice/group; mixed-effects analysis with Sidak’s post hoc analysis * p < 0.05, ** p < 0.01). g sm-FISH for the mitochondrially encoded gene Cytb ( n = 4/group; two-tailed unpaired t -test or unpaired nonparametric Kolmogorov–Smirnov test * p < 0.05, **** p < 0.0001). h sm-FISH for the nuclear-encoded mitochondrial gene Atp5a1 ( n = 4/group; two-tailed unpaired t -test or unpaired nonparametric Kolmogorov–Smirnov test *** p < 0.001). Numbers on bars are cell counts from each experiment. Scale bars correspond to 50 µm a . Error bars represent ±SEM.

Article Snippet: Viruses included AAV9.rTH.PI.Cre.SV40 (AAV9: ThCre ; AddGene# 107788), AAV5-h Syn -GFP-Cre (University of North Carolina Vector Core), AAV5: Gfp , or AAV5: Esrrg (Plasmids generated and cloned into AAV2 backbone with CAG promoter Addgene# 28014 by Genscript; packaged into an AAV5 by Vectorbiolabs; AAV5:CAG- Esrrg- NM_011935.3-IRES-EGFP-WPRE; virus titer 2.0 × 10 12 GC/ml).

Techniques: Two Tailed Test, Injection

a sm-FISH for Th (red) and Esrrg (green) in mice with AAV: Gfp or AAV: Esrrg midbrain injections, quantified in b ( n = 6 mice/group; two-tailed unpaired t -test * p < 0.05). c , d sm-FISH quantification for nuclear encoded mitochondrial gene Cox4i1 and mitochondrially encoded gene mt-cytb ( n = 6/group two-tailed unpaired t -test or unpaired nonparametric Kolmogorov–Smirnov test **** p < 0.0001). e sm-FISH for Th (red) followed by immunofluorescence for phosphorylated α-synuclein (p-syn; green) at 1 month post-injection (P.I.). f Mean pixel density (occupancy of the cytoplasm) for p-syn per neuron at 1, 3 and 6 months P.I. ( n = 4–6 mice/group; two-tailed unpaired t -test at each time-point ** p < 0.005). g Percent of Th + with presence of an inclusion for p-syn ( n = 4–6 mice/group; two-tailed unpaired t -test at each time-point * p < 0.05, ** p < 0.005). h , i Immunofluorescence for TH or DAT in the striatum of mice injected with AAV: Gfp or AAV: Esrrg and/or monomer or PFFs ( n = 6 mice/group; mixed-effects analysis with Sidak’s post hoc analysis at each time-point * p < 0.05, ** p < 0.005, *** p < 0.001, **** p < 0.0001). j Neurons positive for TH immunoreactivity in mice injected with AAV: Gfp or AAV: Esrrg and/or monomer or PFFs ( n = 6 mice/group; mixed-effects analysis with Sidak’s post hoc analysis at each time-point * p < 0.05, ** p < 0.05). k , l Scatter plots to graph SNc TH neuron count and striatal TH intensity per animal at 3 and 6-months P.I. Numbers on bars are cell counts from each experiment. Scale bars correspond to 50 µm ( a ),100 µm ( e , j ), and 500 µm ( h , i ). Error bars represent ±SEM.

Journal: NPJ Parkinson's Disease

Article Title: Estrogen-related receptor gamma regulates mitochondrial and synaptic genes and modulates vulnerability to synucleinopathy

doi: 10.1038/s41531-022-00369-w

Figure Lengend Snippet: a sm-FISH for Th (red) and Esrrg (green) in mice with AAV: Gfp or AAV: Esrrg midbrain injections, quantified in b ( n = 6 mice/group; two-tailed unpaired t -test * p < 0.05). c , d sm-FISH quantification for nuclear encoded mitochondrial gene Cox4i1 and mitochondrially encoded gene mt-cytb ( n = 6/group two-tailed unpaired t -test or unpaired nonparametric Kolmogorov–Smirnov test **** p < 0.0001). e sm-FISH for Th (red) followed by immunofluorescence for phosphorylated α-synuclein (p-syn; green) at 1 month post-injection (P.I.). f Mean pixel density (occupancy of the cytoplasm) for p-syn per neuron at 1, 3 and 6 months P.I. ( n = 4–6 mice/group; two-tailed unpaired t -test at each time-point ** p < 0.005). g Percent of Th + with presence of an inclusion for p-syn ( n = 4–6 mice/group; two-tailed unpaired t -test at each time-point * p < 0.05, ** p < 0.005). h , i Immunofluorescence for TH or DAT in the striatum of mice injected with AAV: Gfp or AAV: Esrrg and/or monomer or PFFs ( n = 6 mice/group; mixed-effects analysis with Sidak’s post hoc analysis at each time-point * p < 0.05, ** p < 0.005, *** p < 0.001, **** p < 0.0001). j Neurons positive for TH immunoreactivity in mice injected with AAV: Gfp or AAV: Esrrg and/or monomer or PFFs ( n = 6 mice/group; mixed-effects analysis with Sidak’s post hoc analysis at each time-point * p < 0.05, ** p < 0.05). k , l Scatter plots to graph SNc TH neuron count and striatal TH intensity per animal at 3 and 6-months P.I. Numbers on bars are cell counts from each experiment. Scale bars correspond to 50 µm ( a ),100 µm ( e , j ), and 500 µm ( h , i ). Error bars represent ±SEM.

Article Snippet: Viruses included AAV9.rTH.PI.Cre.SV40 (AAV9: ThCre ; AddGene# 107788), AAV5-h Syn -GFP-Cre (University of North Carolina Vector Core), AAV5: Gfp , or AAV5: Esrrg (Plasmids generated and cloned into AAV2 backbone with CAG promoter Addgene# 28014 by Genscript; packaged into an AAV5 by Vectorbiolabs; AAV5:CAG- Esrrg- NM_011935.3-IRES-EGFP-WPRE; virus titer 2.0 × 10 12 GC/ml).

Techniques: Two Tailed Test, Immunofluorescence, Injection

a , b q-rt-PCR data from midbrain of mice lacking Esrrg (AAV- hsynCre Esrrg fl/fl vs. AAV- hsynCre Esrrg +/+ ) or of mice overexpressing Esrrg (AAV- Esrrg vs. AAV- Gfp ) ( n = 7–8/group; two-tailed unpaired t -test * p < 0.05, ** p < 0.01). c Representative images from sm-FISH for Th (red), Esrrg (white), endogenous GFP-L10a (green), and DAPI (blue) in Esrrg +/+ ;L10+ and Esrrg fl/fl ; L10+ mice injected with AAV: ThCre to induce the Gfp-Rpl10a transgene in DAergic neurons. d q-rt-PCR from BAC-TRAP pulldowns for Th , Gad65 and Esrrg transcript for confirmation of enrichment of DAergic markers and exclusion of inhibitory neuron markers ( n = 2–3/group; one-way ANOVA with Tukey’s post hoc analysis ** p < 0.01, *** p < 0.001). e Volcano plot showing differentially expressed genes in AAV: ThCre -injected Esrrg +/+ ; L10+ and Esrrg fl/fl ; L10+ mice after sequencing (gray = no significance, green = ±1.5 log 2 -fold change, blue = significant p adj value, red = significant p adj value and differentially expressed ±1.5 log 2 -fold change). f Fold control expression of genes downregulated with Esrrg deletion by functional category. g Fold control of ETC genes reduced in PD patients that had significant p adj values but not ±1.5 log 2 fold change. h Pie chart demonstrating overlap between genes changed with Esrrg overexpression in SH-SY5Ys and genes changed with Esrrg knockout with BAC-TRAP. Q-rt-PCR with Esrrg knockout or overexpression from genes identified as putative targets of Esrrg ( n = 5–8 mice/group; two-tailed unpaired t -tests * p < 0.05, ** p < 0.01). i Overlap of predicted PD GWAS and QTL genes and genes changed with Esrrg knockout using BAC-TRAP in DAergic neurons. qPCR from targets in both Esrrg knockout and overexpression in the midbrain ( n = 5–8 mice; two-tailed unpaired t -test * p < 0.05). j , k sm-FISH for the identified targets Kcns3 and Dgkq at both 1 and 6 months P.I. of AAV- ThCre ( n = 3–4/group; two-tailed unpaired t -test * p < 0.05, ** p < 0.01). l q-rt-PCR from Esrrg knockout (AAV- hsynCre ) or overexpression (AAV- Esrrg ) midbrain homogenate for autophagy and microtubule and vesicle-related genes ( n = 5–8 mice/group; two-tailed unpaired t -test * p < 0.05, ** p < 0.01, *** p < 0.001). Numbers on bars are cell counts from each experimental group. Scale bars correspond to 50 µm ( c ). Error bars re p resent ± SEM.

Journal: NPJ Parkinson's Disease

Article Title: Estrogen-related receptor gamma regulates mitochondrial and synaptic genes and modulates vulnerability to synucleinopathy

doi: 10.1038/s41531-022-00369-w

Figure Lengend Snippet: a , b q-rt-PCR data from midbrain of mice lacking Esrrg (AAV- hsynCre Esrrg fl/fl vs. AAV- hsynCre Esrrg +/+ ) or of mice overexpressing Esrrg (AAV- Esrrg vs. AAV- Gfp ) ( n = 7–8/group; two-tailed unpaired t -test * p < 0.05, ** p < 0.01). c Representative images from sm-FISH for Th (red), Esrrg (white), endogenous GFP-L10a (green), and DAPI (blue) in Esrrg +/+ ;L10+ and Esrrg fl/fl ; L10+ mice injected with AAV: ThCre to induce the Gfp-Rpl10a transgene in DAergic neurons. d q-rt-PCR from BAC-TRAP pulldowns for Th , Gad65 and Esrrg transcript for confirmation of enrichment of DAergic markers and exclusion of inhibitory neuron markers ( n = 2–3/group; one-way ANOVA with Tukey’s post hoc analysis ** p < 0.01, *** p < 0.001). e Volcano plot showing differentially expressed genes in AAV: ThCre -injected Esrrg +/+ ; L10+ and Esrrg fl/fl ; L10+ mice after sequencing (gray = no significance, green = ±1.5 log 2 -fold change, blue = significant p adj value, red = significant p adj value and differentially expressed ±1.5 log 2 -fold change). f Fold control expression of genes downregulated with Esrrg deletion by functional category. g Fold control of ETC genes reduced in PD patients that had significant p adj values but not ±1.5 log 2 fold change. h Pie chart demonstrating overlap between genes changed with Esrrg overexpression in SH-SY5Ys and genes changed with Esrrg knockout with BAC-TRAP. Q-rt-PCR with Esrrg knockout or overexpression from genes identified as putative targets of Esrrg ( n = 5–8 mice/group; two-tailed unpaired t -tests * p < 0.05, ** p < 0.01). i Overlap of predicted PD GWAS and QTL genes and genes changed with Esrrg knockout using BAC-TRAP in DAergic neurons. qPCR from targets in both Esrrg knockout and overexpression in the midbrain ( n = 5–8 mice; two-tailed unpaired t -test * p < 0.05). j , k sm-FISH for the identified targets Kcns3 and Dgkq at both 1 and 6 months P.I. of AAV- ThCre ( n = 3–4/group; two-tailed unpaired t -test * p < 0.05, ** p < 0.01). l q-rt-PCR from Esrrg knockout (AAV- hsynCre ) or overexpression (AAV- Esrrg ) midbrain homogenate for autophagy and microtubule and vesicle-related genes ( n = 5–8 mice/group; two-tailed unpaired t -test * p < 0.05, ** p < 0.01, *** p < 0.001). Numbers on bars are cell counts from each experimental group. Scale bars correspond to 50 µm ( c ). Error bars re p resent ± SEM.

Article Snippet: Viruses included AAV9.rTH.PI.Cre.SV40 (AAV9: ThCre ; AddGene# 107788), AAV5-h Syn -GFP-Cre (University of North Carolina Vector Core), AAV5: Gfp , or AAV5: Esrrg (Plasmids generated and cloned into AAV2 backbone with CAG promoter Addgene# 28014 by Genscript; packaged into an AAV5 by Vectorbiolabs; AAV5:CAG- Esrrg- NM_011935.3-IRES-EGFP-WPRE; virus titer 2.0 × 10 12 GC/ml).

Techniques: Reverse Transcription Polymerase Chain Reaction, Two Tailed Test, Injection, Sequencing, Control, Expressing, Functional Assay, Over Expression, Knock-Out

a – c sm-FISH quantification of select Esrrg -dependent genes in DAergic neurons with and without phosphorylated α-synuclein (p-syn) inclusions ( n = 6–14/group; two-tailed unpaired t -test or one-way ANOVA with Tukey’s post hoc analyses * p < 0.05, ** p < 0.01). d Venn diagram showing overlap with genes from BAC-TRAP with Esrrg deletion and day 21 post in vitro PFF treated neurons. e Venn diagram showing overlap between BAC-TRAP with Esrrg deletion and PGC-1α overexpression in SH-SY5Y’s. f Protein-protein-interaction model to identify convergent targets of transcripts altered by Esrrg deletion as detected by BAC-TRAP. g Gene Ontology molecular function as identified with Enrichr from proteins generated from BAC-TRAP PPI. h Top DAergic neuron hits from BAC-TRAP PPI data by connectivity score and abundance and relative enrichment in DAergic neurons; green signifies druggable target. i Overlap of BAC-TRAP PPI proteins with convergent proteins identified in a PPI generated from PD GWAS and QTL. Numbers on bars are cell counts from each experiment. Scale bars correspond to 10 µm ( a – c ). Error bars represent ±SEM.

Journal: NPJ Parkinson's Disease

Article Title: Estrogen-related receptor gamma regulates mitochondrial and synaptic genes and modulates vulnerability to synucleinopathy

doi: 10.1038/s41531-022-00369-w

Figure Lengend Snippet: a – c sm-FISH quantification of select Esrrg -dependent genes in DAergic neurons with and without phosphorylated α-synuclein (p-syn) inclusions ( n = 6–14/group; two-tailed unpaired t -test or one-way ANOVA with Tukey’s post hoc analyses * p < 0.05, ** p < 0.01). d Venn diagram showing overlap with genes from BAC-TRAP with Esrrg deletion and day 21 post in vitro PFF treated neurons. e Venn diagram showing overlap between BAC-TRAP with Esrrg deletion and PGC-1α overexpression in SH-SY5Y’s. f Protein-protein-interaction model to identify convergent targets of transcripts altered by Esrrg deletion as detected by BAC-TRAP. g Gene Ontology molecular function as identified with Enrichr from proteins generated from BAC-TRAP PPI. h Top DAergic neuron hits from BAC-TRAP PPI data by connectivity score and abundance and relative enrichment in DAergic neurons; green signifies druggable target. i Overlap of BAC-TRAP PPI proteins with convergent proteins identified in a PPI generated from PD GWAS and QTL. Numbers on bars are cell counts from each experiment. Scale bars correspond to 10 µm ( a – c ). Error bars represent ±SEM.

Article Snippet: Viruses included AAV9.rTH.PI.Cre.SV40 (AAV9: ThCre ; AddGene# 107788), AAV5-h Syn -GFP-Cre (University of North Carolina Vector Core), AAV5: Gfp , or AAV5: Esrrg (Plasmids generated and cloned into AAV2 backbone with CAG promoter Addgene# 28014 by Genscript; packaged into an AAV5 by Vectorbiolabs; AAV5:CAG- Esrrg- NM_011935.3-IRES-EGFP-WPRE; virus titer 2.0 × 10 12 GC/ml).

Techniques: Two Tailed Test, In Vitro, Over Expression, Generated

Shuttle vector rescue of targeted loci. ( A ) Maps of AAV targeting vector AAV2-HSN5′ containing a neo gene truncated at bp 629 and an MLV vector LHSN37Δ4O provirus containing a 4-bp deletion in neo at bp 37. The locations of the AAV inverted terminal repeats (ITRs), simian virus 40 (SV40) and Tn5 promoters, transcriptional start sites (arrows), hph and neo genes, p15A replication origin, and retrovirus long terminal repeats (LTR) are shown. The fragment used to probe Southern blots is indicated. The strategy used for recovering targeted loci is shown below. ( B ) Southern blot of genomic DNA from HT-1080-derived clonal cell lines containing a single copy of the LHSN37Δ4O provirus, digested with EcoRI and probed for hph sequences. The positions of size standards are shown on the left. ( C ) Southern blot of genomic DNA from HT-1080-derived clonal cell lines containing two copies of the LHSN37Δ4O provirus, with clone 17 as a single-copy control, digested and probed as in (B).

Journal: Nucleic Acids Research

Article Title: Chromosomal position effects on AAV-mediated gene targeting

doi: 10.1093/nar/gkq095

Figure Lengend Snippet: Shuttle vector rescue of targeted loci. ( A ) Maps of AAV targeting vector AAV2-HSN5′ containing a neo gene truncated at bp 629 and an MLV vector LHSN37Δ4O provirus containing a 4-bp deletion in neo at bp 37. The locations of the AAV inverted terminal repeats (ITRs), simian virus 40 (SV40) and Tn5 promoters, transcriptional start sites (arrows), hph and neo genes, p15A replication origin, and retrovirus long terminal repeats (LTR) are shown. The fragment used to probe Southern blots is indicated. The strategy used for recovering targeted loci is shown below. ( B ) Southern blot of genomic DNA from HT-1080-derived clonal cell lines containing a single copy of the LHSN37Δ4O provirus, digested with EcoRI and probed for hph sequences. The positions of size standards are shown on the left. ( C ) Southern blot of genomic DNA from HT-1080-derived clonal cell lines containing two copies of the LHSN37Δ4O provirus, with clone 17 as a single-copy control, digested and probed as in (B).

Article Snippet: AAV2 vector plasmid pA2HSN5′ contains pLHSNO sequences including 309-bp 5′ to the hph gene, the hph gene, the SV40 early and Tn5 promoters, and the 5′ portion of the neo gene (truncated at the NaeI site at bp 629 of the coding sequence), inserted into a backbone based on pAAV-hrGFP (Avigen, Alameda, CA, USA).

Techniques: Plasmid Preparation, Southern Blot, Derivative Assay

Gene targeting frequencies of clonal cell lines. ( A ) Frequencies in clones containing one LHSN37Δ4O target locus infected with AAV2-HSN5′ at an MOI of 10 000 vector particles/cell. ( B ) Frequencies in clones containing two LHSN37Δ4O target loci infected as in (A). ( C ) Partial gene targeting frequencies for each target ( a or b ) present in cell lines containing two targets.

Journal: Nucleic Acids Research

Article Title: Chromosomal position effects on AAV-mediated gene targeting

doi: 10.1093/nar/gkq095

Figure Lengend Snippet: Gene targeting frequencies of clonal cell lines. ( A ) Frequencies in clones containing one LHSN37Δ4O target locus infected with AAV2-HSN5′ at an MOI of 10 000 vector particles/cell. ( B ) Frequencies in clones containing two LHSN37Δ4O target loci infected as in (A). ( C ) Partial gene targeting frequencies for each target ( a or b ) present in cell lines containing two targets.

Article Snippet: AAV2 vector plasmid pA2HSN5′ contains pLHSNO sequences including 309-bp 5′ to the hph gene, the hph gene, the SV40 early and Tn5 promoters, and the 5′ portion of the neo gene (truncated at the NaeI site at bp 629 of the coding sequence), inserted into a backbone based on pAAV-hrGFP (Avigen, Alameda, CA, USA).

Techniques: Clone Assay, Infection, Plasmid Preparation

Northern blot analysis and effect of trichostatin A (TSA) on gene targeting. ( A ) Northern blot of total RNA extracted from the HT-1080-derived clonal cell lines containing a single copy of the LHSN37Δ4O provirus having the two lowest (clones 27 and 14) and two highest (clones 42 and 21) gene targeting frequencies. The blot was probed for neo transcripts and for GAPDH transcripts to check loading. The positions of size standards are shown on the left, and the three expected neo transcript forms (full-length, spliced or short) and corresponding sizes are indicated on the right. ( B ) Comparison of targeting frequencies (calculated relative to targeting frequency of clone 27) and neo transcript levels (calculated relative to full-length transcript of clone 27) for the four clones. ( C ) Gene targeting frequencies in four clones treated with or without 125 nM TSA from 4.5 h after infection with AAV2-HSN5′ at an MOI of 10 000 vector particles/cell until splitting.

Journal: Nucleic Acids Research

Article Title: Chromosomal position effects on AAV-mediated gene targeting

doi: 10.1093/nar/gkq095

Figure Lengend Snippet: Northern blot analysis and effect of trichostatin A (TSA) on gene targeting. ( A ) Northern blot of total RNA extracted from the HT-1080-derived clonal cell lines containing a single copy of the LHSN37Δ4O provirus having the two lowest (clones 27 and 14) and two highest (clones 42 and 21) gene targeting frequencies. The blot was probed for neo transcripts and for GAPDH transcripts to check loading. The positions of size standards are shown on the left, and the three expected neo transcript forms (full-length, spliced or short) and corresponding sizes are indicated on the right. ( B ) Comparison of targeting frequencies (calculated relative to targeting frequency of clone 27) and neo transcript levels (calculated relative to full-length transcript of clone 27) for the four clones. ( C ) Gene targeting frequencies in four clones treated with or without 125 nM TSA from 4.5 h after infection with AAV2-HSN5′ at an MOI of 10 000 vector particles/cell until splitting.

Article Snippet: AAV2 vector plasmid pA2HSN5′ contains pLHSNO sequences including 309-bp 5′ to the hph gene, the hph gene, the SV40 early and Tn5 promoters, and the 5′ portion of the neo gene (truncated at the NaeI site at bp 629 of the coding sequence), inserted into a backbone based on pAAV-hrGFP (Avigen, Alameda, CA, USA).

Techniques: Northern Blot, Derivative Assay, Clone Assay, Infection, Plasmid Preparation